---
title: CRISPR quickstart
description: >-
  Step-by-step workflows for guide RNA design, off-target analysis, and CRISPR
  screen hit identification.
tags:
  - crispr
  - quickstart
---

You want to design and validate a genome-editing experiment; these workflows walk you from a gene symbol to scored guide RNAs, off-target risk, or ranked screen hits in three steps each. See [CRISPR on the platform](/docs/crispr) for tool details.

## CRISPR quickstart

This guide covers three common workflows: designing guide RNAs for a target gene, evaluating off-target risk, and analyzing CRISPR screen results.

## Workflow 1: Design guide RNAs

### Step 1: Specify your target gene

Ask Ivy in chat (or submit the job directly with `POST /api/v1/jobs`; see the [API reference](/docs/api)):

```
Design CRISPR guide RNAs for TP53
```

Ivy runs CRISPR guide design to identify PAM sites and score candidate guides.

### Step 2: Review the guide table

| Rank | Guide Sequence (20-nt) | PAM | Strand | GC% | On-Target Score | Position |
|------|------------------------|-----|--------|-----|-----------------|----------|
| 1 | ATCGATCGATCGATCGATCG | NGG | + | 55 | 0.82 | chr17:7675100 |
| 2 | GCTAGCTAGCTAGCTAGCTA | NGG | - | 50 | 0.76 | chr17:7675250 |
| 3 | TTCGATCGATCGATCGATCG | NGG | + | 45 | 0.71 | chr17:7675400 |

### Step 3: Filter by criteria (optional)

```
Show only guides with GC content between 40% and 60% and on-target score above 0.7
```

This narrows results to guides with optimal GC content and high predicted activity.

## Workflow 2: Check off-target risk

### Step 1: Submit a guide for off-target analysis

```
Check off-target sites for the guide ATCGATCGATCGATCGATCG
```

Or configure manually:

| Parameter | Value |
|-----------|-------|
| Guide sequences | `["ATCGATCGATCGATCGATCG"]` |
| Genome | `GRCh38` |
| Max mismatches | `3` |

### Step 2: Review off-target results

| Off-Target Sequence | Mismatches | Chromosome | Position | Gene | In CDS |
|---------------------|------------|------------|----------|------|--------|
| ATCGATCGATCGATCGATCG | 0 | chr17 | 7675100 | TP53 | Yes |
| ATCAATCGATCGATCGATCG | 1 | chr5 | 12340000 | -- | No |
| ATCGATCAATCGATCGATCG | 1 | chr11 | 45670000 | NEAT1 | No |

### Step 3: Interpret the results

| Mismatches | Risk Level | Guidance |
|------------|------------|----------|
| 0 | On-target | Expected; this is your intended cut site |
| 1 | High | Likely to be cut; avoid guides with 1-mismatch sites in coding regions |
| 2 | Moderate | May be cut at reduced efficiency; evaluate genomic context |
| 3 | Low | Unlikely to be cut; generally acceptable |

## Workflow 3: Analyze a CRISPR screen

### Step 1: Submit screen data

```
Analyze my CRISPR screen results to find essential genes
```

Or configure manually:

| Parameter | Value |
|-----------|-------|
| Count table | Upload read count file (CSV/TSV) |
| Control samples | `["control_rep1", "control_rep2"]` |
| Treatment samples | `["treatment_rep1", "treatment_rep2"]` |
| Analysis direction | `negative` (depletion/essentiality) |

### Step 2: Review gene rankings

| Rank | Gene | RRA Score | P-value | FDR | Guides Significant |
|------|------|-----------|---------|-----|-------------------|
| 1 | CDK1 | 2.3e-8 | 1.1e-7 | 3.2e-5 | 4/4 |
| 2 | PLK1 | 5.6e-7 | 2.8e-6 | 4.1e-4 | 3/4 |
| 3 | AURKB | 1.2e-6 | 6.0e-6 | 5.8e-4 | 3/4 |

### Step 3: Understand the statistics

| Metric | Meaning |
|--------|---------|
| RRA Score | Robust Rank Aggregation score; lower = more significant |
| P-value | Statistical significance of gene-level depletion/enrichment |
| FDR | False discovery rate (Benjamini-Hochberg adjusted p-value) |
| Guides Significant | Number of guides showing consistent effect out of total guides per gene |

## Next steps

- See [inputs](/docs/crispr/inputs) for all parameters, PAM types, and scoring options
- See [outputs](/docs/crispr/outputs) for result field descriptions and score interpretation
- Use [Genomics](/docs/genomics) for gene information before designing guides
- Use [Epigenomics](/docs/epigenomics) to check chromatin accessibility at guide target sites

## Read next