Gene targets, PAM types, scoring models, mismatch thresholds, and screen analysis options for all CRISPR tools.

You provide a target gene, guide sequence, genomic region, or screen count table; for guide design, the on-target scoring model and your GC and score filters most shape which guides rise to the top.

CRISPR inputs and parameters

Common input formats

Most CRISPR tools accept one of these input types:

Input	Format	Example	Accepted By
Gene symbol	Standard HGNC symbol	`BRCA1`, `TP53`, `KRAS`	`crispr_design_guides`
Guide sequence	20-nt DNA string	`ATCGATCGATCGATCGATCG`	`crispr_offtarget`
Genomic region	chr:start-end	`chr17:7668402-7687550`	`crispr_design_guides`
Count table	CSV/TSV file	Read count matrix	`crispr_screen_analyze`

Guide RNA Design parameters

Parameter	Type	Required	Default	Description
`gene`	string	Yes*	--	Target gene symbol (HGNC)
`sequence`	string	Yes*	--	Target DNA sequence (alternative to gene)
`pam`	string	No	`"NGG"`	PAM sequence for the Cas nuclease
`guide_length`	integer	No	`20`	Guide RNA length in nucleotides (17-25)
`organism`	string	No	`"human"`	Target organism
`min_gc`	number	No	`20`	Minimum GC content percentage (0-100)
`max_gc`	number	No	`80`	Maximum GC content percentage (0-100)
`min_score`	number	No	`0.0`	Minimum on-target score filter (0-1)
`max_guides`	integer	No	`20`	Maximum number of guides to return (1-100)
`exon_filter`	string	No	--	Restrict to specific exon (e.g., `"exon3"`)

*One of gene or sequence is required.

Supported PAM sequences

PAM	Nuclease	Notes
`NGG`	SpCas9	Default; most commonly used
`NNGRRT`	SaCas9	Smaller nuclease, suitable for AAV delivery
`TTTV`	AsCas12a (Cpf1)	Staggered cut, AT-rich PAM
`NGAN`	SpCas9-VQR	Engineered variant for broader targeting
Custom	Any	Provide any IUPAC-encoded PAM string

IUPAC nucleotide codes

Code	Bases	Code	Bases
`N`	A, C, G, T	`R`	A, G
`V`	A, C, G	`Y`	C, T
`H`	A, C, T	`K`	G, T
`D`	A, G, T	`M`	A, C
`B`	C, G, T	`S`	G, C
		`W`	A, T

On-target scoring model

The guide design tool uses the Rule Set 2 algorithm (Doench et al., 2016) for on-target activity prediction. The score considers:

Nucleotide identity at each position of the 30-mer context (guide + flanking)
GC content of the guide
Melting temperature
Position-specific dinucleotide features

Scores range from 0 to 1. Guides with scores above 0.5 are generally considered active; scores above 0.7 indicate high predicted efficiency.

Off-Target Analysis parameters

Parameter	Type	Required	Default	Description
`guides`	string[]	Yes	--	Guide RNA sequences to analyze (1-10, each 17-25 nt)
`genome`	string	No	`"GRCh38"`	Reference genome assembly
`max_mismatches`	integer	No	`3`	Maximum mismatches to report (0-5)
`pam`	string	No	`"NGG"`	PAM sequence (filters off-target sites)
`include_cds_only`	boolean	No	`false`	Only report off-targets in coding sequences

Supported reference genomes

Genome	Organism	Assembly
`GRCh38`	Human	GRCh38/hg38
`GRCm39`	Mouse	GRCm39/mm39
`Rnor_6.0`	Rat	Rnor_6.0/rn6

Mismatch scoring

Off-target sites are scored based on mismatch position relative to the PAM:

Region	Positions	Impact
Seed region	1-12 (PAM-proximal)	Mismatches here strongly reduce cutting
Non-seed region	13-20 (PAM-distal)	Mismatches tolerated more readily

A guide with zero 1-mismatch off-target sites and fewer than five 2-mismatch sites in coding regions is generally considered safe for most applications.

Screen Analysis parameters

Parameter	Type	Required	Default	Description
`count_table`	file	Yes	--	Read count matrix (CSV/TSV with gene, guide, sample columns)
`control_samples`	string[]	Yes	--	Column names for control/reference samples
`treatment_samples`	string[]	Yes	--	Column names for treatment/experimental samples
`direction`	string	No	`"both"`	Analysis direction: `"negative"` (depletion), `"positive"` (enrichment), `"both"`
`fdr_threshold`	number	No	`0.25`	FDR cutoff for significant hits (0-1)
`min_guides`	integer	No	`2`	Minimum guides per gene for inclusion
`normalization`	string	No	`"median"`	Normalization method: `"median"`, `"total"`, `"none"`

Count table format

The count table should be a CSV or TSV file with the following structure:

Column	Description
`gene`	Gene symbol targeted by the guide
`guide`	Guide RNA identifier or sequence
Sample columns	Raw read counts for each sample (one column per replicate)

Example:

gene,guide,control_rep1,control_rep2,treatment_rep1,treatment_rep2
TP53,guide_1,1500,1400,200,180
TP53,guide_2,1200,1300,150,160
BRCA1,guide_1,800,900,750,820

Analysis direction

Direction	Identifies	Use Case
`negative`	Genes whose guides are depleted in treatment	Essential genes, synthetic lethal partners
`positive`	Genes whose guides are enriched in treatment	Resistance genes, tumor suppressors
`both`	Both depleted and enriched genes	Comprehensive screen analysis

CRISPR inputs and parameters