CRISPR quickstart
Step-by-step workflows for guide RNA design, off-target analysis, and CRISPR screen hit identification.
You want to design and validate a genome-editing experiment; these workflows walk you from a gene symbol to scored guide RNAs, off-target risk, or ranked screen hits in three steps each. See CRISPR on the platform for tool details.
CRISPR quickstart
This guide covers three common workflows: designing guide RNAs for a target gene, evaluating off-target risk, and analyzing CRISPR screen results.
Workflow 1: Design guide RNAs
Specify your target gene
Ask Ivy in chat (or submit the job directly with POST /api/v1/jobs; see the API reference):
Ivy runs CRISPR guide design to identify PAM sites and score candidate guides.
Review the guide table
| Rank | Guide Sequence (20-nt) | PAM | Strand | GC% | On-Target Score | Position |
|---|---|---|---|---|---|---|
| 1 | ATCGATCGATCGATCGATCG | NGG | + | 55 | 0.82 | chr17:7675100 |
| 2 | GCTAGCTAGCTAGCTAGCTA | NGG | - | 50 | 0.76 | chr17:7675250 |
| 3 | TTCGATCGATCGATCGATCG | NGG | + | 45 | 0.71 | chr17:7675400 |
Filter by criteria (optional)
This narrows results to guides with optimal GC content and high predicted activity.
Workflow 2: Check off-target risk
Submit a guide for off-target analysis
Or configure manually:
| Parameter | Value |
|---|---|
| Guide sequences | ["ATCGATCGATCGATCGATCG"] |
| Genome | GRCh38 |
| Max mismatches | 3 |
Review off-target results
| Off-Target Sequence | Mismatches | Chromosome | Position | Gene | In CDS |
|---|---|---|---|---|---|
| ATCGATCGATCGATCGATCG | 0 | chr17 | 7675100 | TP53 | Yes |
| ATCAATCGATCGATCGATCG | 1 | chr5 | 12340000 | -- | No |
| ATCGATCAATCGATCGATCG | 1 | chr11 | 45670000 | NEAT1 | No |
Interpret the results
| Mismatches | Risk Level | Guidance |
|---|---|---|
| 0 | On-target | Expected; this is your intended cut site |
| 1 | High | Likely to be cut; avoid guides with 1-mismatch sites in coding regions |
| 2 | Moderate | May be cut at reduced efficiency; evaluate genomic context |
| 3 | Low | Unlikely to be cut; generally acceptable |
Workflow 3: Analyze a CRISPR screen
Submit screen data
Or configure manually:
| Parameter | Value |
|---|---|
| Count table | Upload read count file (CSV/TSV) |
| Control samples | ["control_rep1", "control_rep2"] |
| Treatment samples | ["treatment_rep1", "treatment_rep2"] |
| Analysis direction | negative (depletion/essentiality) |
Review gene rankings
| Rank | Gene | RRA Score | P-value | FDR | Guides Significant |
|---|---|---|---|---|---|
| 1 | CDK1 | 2.3e-8 | 1.1e-7 | 3.2e-5 | 4/4 |
| 2 | PLK1 | 5.6e-7 | 2.8e-6 | 4.1e-4 | 3/4 |
| 3 | AURKB | 1.2e-6 | 6.0e-6 | 5.8e-4 | 3/4 |
Understand the statistics
| Metric | Meaning |
|---|---|
| RRA Score | Robust Rank Aggregation score; lower = more significant |
| P-value | Statistical significance of gene-level depletion/enrichment |
| FDR | False discovery rate (Benjamini-Hochberg adjusted p-value) |
| Guides Significant | Number of guides showing consistent effect out of total guides per gene |
Next steps
- See inputs for all parameters, PAM types, and scoring options
- See outputs for result field descriptions and score interpretation
- Use Genomics for gene information before designing guides
- Use Epigenomics to check chromatin accessibility at guide target sites
Read next
Was this page helpful?
How CRISPR guide results compare to the bench
What a Rule Set 3 on-target score has been shown to agree with, why off-target needs AUC-PR not ROC AUC, and why the near-match scan is not genome-wide.
CRISPR troubleshooting
Resolve guide design failures, excessive off-targets, and CRISPR screen analysis issues.